New Place 元件库
469 条记录newPLACE 30.0，469 个元件名。newPLACE 原站域名已失效，本库由存档的 place_dat 与 place_seq 复原。
| 元件名 | 共识序列 | 长度 | 类别 | 子类 | 物种 | 功能 |
|---|---|---|---|---|---|---|
| -10PEHVPSBD | TATTCT | 6 | Circadian | Circadian | barley (Hordeum vulgare) | -10 promoter element found in the barley (H.v.) chloroplast psbD gene promoter |
| -141NTG13 | GCTTTTGATGACTTCAAACAC | 21 | Hormone | Auxin | tobacco (Nicotiana tabacum) | -141 sequence |
| -284MOTIFZMSBE1 | CGTGCAAGCCCAAAGGCCAATCGGCCCAGA | 30 | Development | Seed | maize (Zea mays) | Located between -284 and -255 region of maize (Z.m.) Sbe1 gene promoter |
| -300CORE | TGTAAAG | 7 | Development | Seed | maize (Zea mays); wheat (Triticum aestivum); barley (Hordeum vulgare); tobacco (Nicotiana tabacum) | TGTAAAG core motif in -300 elements of alpha-zein genes of maize |
| -300ELEMENT | TGHAAARK | 8 | Development | Seed | wheat (Triticum aestivum) | Present upstream of the promoter from the B-hordein gene of barley and the alpha-gliadin, gamma-gliadin, and low molecul |
| -300MOTIFZMZEIN | RTGAGTCAT | 9 | Development | Seed | maize (Zea mays) | Motif in -300 elements of alpha-zein genes of maize (Z.m.) |
| -314MOTIFZMSBE1 | ACATAAAATAAAAAAAGGCA | 20 | Development | Seed | maize (Zea mays) | Located between -314 and -295 region of maize (Z.m.) Sbe1 gene promoter |
| 14BPATERD1 | CACTAAATTGTCAC | 14 | Stress | Drought | Arabidopsis thaliana | 14 bp region (from -599 to -566) necessary for expression of erd1 (early responsive to dehydration) in dehydrated Arabid |
| 20NTNTNOS | TGAGCTAAGCACATACGTCA | 20 | Hormone | Auxin | tobacco (Nicotiana tabacum) | 20nt (20 nucleotide sequence) found in the promoter on tobacco (N.t.) nopalin synthase (nos) gene promoter |
| 23BPUASNSCYCB1 | TTTATTTACCAAACGGTAACATC | 23 | Stress | Drought | tobacco (Nicotiana sylvestris) | 23 bp UAS (Upstream activating sequence) found in the promoter of Nicotiana sylvestris (N.s.) CycB1 gene |
| 23BPZM27KDAZEIN | GACGTGTAAAGTAAATTTACAAC | 23 | Development | Seed | maize (Zea mays) | 23 bp sequence found in the maize (Z.m.) gamma-class 27kDa zein gene promoter |
| 27BPDRCONSENSUSPS25S | TCCGCCWCTTGTATTCGTTGCGTTGMA | 27 | Development | Cell cycle | pea (Pisum sativum) | The consensus sequence of 27 bp imperfect repeats found in the untrascribed spacer close to the 3'end of the pea (P.s.) |
| 2SSEEDPROTBANAPA | CAAACAC | 7 | Hormone | ABA | Brassica napus; | Conserved in many storage-protein gene promoters |
| 3AF1BOXPSRBCS3 | AAATAGATAAATAAAAACATT | 21 | Light | Light | pea (Pisum sativum) | 3AF1 binding site |
| 5256BOXLELAT5256 | TGTGGTTATATA | 12 | Development | Pollen | tomato (Lycopersicon esculentum) | 52/56 box |
| 5659BOXLELAT5659 | GAAWTTGTGA | 10 | Development | Pollen | tomato (Lycopersicon esculentum) | 56/59 box |
| AACACOREOSGLUB1 | AACAAAC | 7 | Development | Seed | rice (Oryza sativa) | Core of AACA motifs found in rice (O.s.) glutelin genes, involved in controlling the endosperm-specific expression |
| AACAOSGLUB1 | CAACAAACTATATC | 14 | Development | Seed | rice (Oryza sativa) | AACA motif found in GluB-1 gene in rice (O.s.) |
| AAGACGTAGATACL12 | AAGACGTAG | 9 | Unclassified | Unclassified | Arabidopsis thaliana | Sequence found in Arabidopsis (A.t.) acyl carrier protein (ACP), Acl1.2, gene promoter |
| ABADESI1 | RTACGTGGCR | 10 | Hormone | ABA | rice (Oryza sativa) | Responsive to ABA and desiccation |
| ABADESI2 | GGACGCGTGGC | 11 | Stress | Drought | rice (Oryza sativa); wheat (Triticum aestivum) | Synthetic element (hex-3) related to response to ABA and to desiccation |
| ABAREG2 | ATGTACGAAGC | 11 | Development | Seed | sunflower (Helianthus annuus) | Motif related to ABA regulation |
| ABASEED1 | TGTTACGTGCC | 11 | Hormone | ABA | carrot (Daucus carota) | ABA regulation |
| ABFOS | GCATCTTTACTTTAGCATC | 19 | Development | Meristem | RTBV; rice tungro bacilliform virus; rice (Oryza sativa); | ABF (as-1-like box binding factor) binding site |
| ABRE2HVA1 | CCTACGTGGCGG | 12 | Hormone | ABA | barley (Hordeum vulgare); | ABA responsive element, ABRE2, found in barley (H.v.) HVA1 gene encoding a class 3 late embryogenesis-abundant protein |
| ABRE2HVA22 | CGCACGTGTC | 10 | Hormone | ABA | barley (Hordeum vulgare); | ABRE2 of barley HVA22 gene |
| ABRE3HVA1 | GCAACGTGTC | 10 | Hormone | ABA | barley (Hordeum vulgare); | ABA responsive element, ABRE3, found in barley (H.v.) HVA1 gene encoding a class 3 late embryogenesis-abundant protein |
| ABRE3HVA22 | GCCACGTACA | 10 | Hormone | ABA | barley (Hordeum vulgare); | ABRE3 of barley HVA22 gene |
| ABRE3OSRAB16 | GTACGTGGCGC | 11 | Hormone | ABA | rice (Oryza sativa); | ABA-responsive element of rice (O.s.) rab16 and alpha-amylase genes |
| ABREA2HVA1 | CCTACGTGGC | 10 | Hormone | ABA | barley (Hordeum vulgare) | A2 of ABRC3 |
| ABREATCONSENSUS | YACGTGGC | 8 | Hormone | ABA | Arabidopsis thaliana | ABA-responsive elements (ABREs) found in the promoter of ABA and/or stress-regulated genes |
| ABREATRD22 | RYACGTGGYR | 10 | Hormone | ABA | Arabidopsis thaliana | ABRE (ABA responsive element) in Arabidopsis (A.t.) dehydration-responsive gene rd22 |
| ABREAZMRAB28 | GCCACGTGGG | 10 | Hormone | ABA | maize (Zea mays) | ABA-responsive element (ABRE A) found at -148 to -139 in maize rab28 (Busk & Pages, 1997) |
| ABREBNNAPA | CGCCACGTGTCC | 12 | Hormone | ABA | Brassica napus; | ABRE of napA storage-protein gene of Brassica napus (B.n.) |
| ABREBZMRAB28 | TCCACGTCTC | 10 | Hormone | ABA | maize (Zea mays) | ABA-responsive element (ABRE B) found at -105 to -96 in maize (Z.m.) rab28 (Busk & Pages, 1997) |
| ABRECE1HVA22 | TGCCACCGG | 9 | Hormone | ABA | barley (Hordeum vulgare) | CE1(coupling element 1) of barley HVA22 gene |
| ABRECE3HVA1 | ACGCGTGTCCTC | 12 | Hormone | ABA | barley (Hordeum vulgare); | CE3 (coupling element 3) of ABRC3 in barley HVA1 gene |
| ABRECE3ZMRAB28 | ACGCGCCTCCTC | 12 | Hormone | ABA | maize (Zea mays) | CE3 (coupling element 3) in maize (Z.m.) rab28 gene promoter |
| ABREDISTBBNNAPA | GCCACTTGTC | 10 | Hormone | ABA | Brassica napus | dist B (distal portion of B-box) found in napA gene of Brassica napus (B.n.) |
| ABRELATERD1 | ACGTG | 5 | Light | Light | Arabidopsis thaliana | ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydrati |
| ABREMOTIFAOSOSEM | TACGTGTC | 8 | Hormone | ABA | rice (Oryza sativa) | motif A ABRE-like sequence found in rice (O.s.) Osem gene promoter |
| ABREMOTIFIIIOSRAB16B | GCCGCGTGGC | 10 | Hormone | ABA | rice (Oryza sativa) | Motif III found in the promoter of rice (O.s.) rab16B gene |
| ABREMOTIFIOSRAB16B | AGTACGTGGC | 10 | Hormone | ABA | rice (Oryza sativa) | Motif I found in the promoter of rice (O.s.) rab16B gene |
| ABREOSRAB21 | ACGTSSSC | 8 | Hormone | ABA | rice (Oryza sativa); wheat (Triticum aestivum) | ABA responsive element (ABRE) of wheat Em and rice (O.s.) rab21 genes |
| ABRERATCAL | MACGYGB | 7 | Hormone | ABA | Arabidopsis thaliana | ABRE-related sequence or Repeated sequence motifs identified in the upstream regions of 162 Ca(2+)-responsive upregulate |
| ABRETAEM | GGACACGTGGC | 11 | Hormone | ABA | wheat (Triticum aestivum) | ABRE (ABA responsive element) found in wheat (T.a.) Em gene |
| ABREZMRAB28 | CCACGTGG | 8 | Hormone | ABA | maize (Zea mays); Arabidopsis thaliana; rice (Oryza sativa); Populus spp.; | ABRE |
| ACEATCHS | GACACGTAGA | 10 | Light | Light | Arabidopsis thaliana | ACEAtCHS (ACGT containing element) found in the LRU (light-responsive unit) in Arabidopsis (A.t.) chalcone synthase (CHS |
| ACGTABOX | TACGTA | 6 | Development | Seed | plant; rice (Oryza sativa); | A-box according to the nomenclature of ACGT elements by Foster et al. (FASEB J 8:192-200 (1994)) |
| ACGTABREMOTIFA2OSEM | ACGTGKC | 7 | Hormone | ABA | rice (Oryza sativa); Arabidopsis thaliana; | Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM |
| ACGTABREMOTIFAOSOSEM | TACGTGTC | 8 | Hormone | ABA | rice (Oryza sativa) | ABRE motif A found in the promoter of the rice (O.s.) Osem gene |
| ACGTATERD1 | ACGT | 4 | Light | Light | Arabidopsis thaliana | ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) i |
| ACGTCBOX | GACGTC | 6 | Development | Seed | plant; | C-box according to the nomenclature of ACGT elements by Foster et al. (FASEB J 8:192-200 (1994)) |
| ACGTOSGLUB1 | GTACGTG | 7 | Development | Seed | rice (Oryza sativa) | ACGT motif found in GluB-1 gene in rice (O.s.) |
| ACGTROOT1 | GCCACGTGGC | 10 | Hormone | ABA | tobacco (Nicotiana tabacum); soybean (Glycine max) | ACGT motif related to root expression |
| ACGTSEED2 | ACACACGTCAA | 11 | Development | Seed | French bean; bean (Phaseolus vulgaris) | ACGT motif related to seed expression |
| ACGTSEED3 | GTACGTGGCG | 10 | Development | Seed | tobacco | ACGT motif related to seed expression |
| ACGTTBOX | AACGTT | 6 | Unclassified | Unclassified | plant; | T-box according to the nomenclature of ACGT elements by Foster et al. (FASEB J 8:192-200 (1994)) |
| ACIIIPVPAL2 | GTTAGGTTC | 9 | Stress | Drought | bean (Phaseolus vulgaris); Pinus taeda (loblolly pine); | ACIII element found at -246 to -238 of bean (P.v.) PAL2 promoter |
| ACIIPVPAL2 | CCACCAACCCCC | 12 | Stress | Drought | bean (Phaseolus vulgaris); Pinus taeda (loblolly pine); | ACII element found at -131 to -120 of bean (P.v.) PAL2 promoter |
| ACIPVPAL2 | CCCACCTACC | 10 | Stress | Drought | Phaseolus vulgaris(bean); Pinus taeda (loblolly pine); | ACI element found at -83 to -74 of bean (P.v.) PAL2 promoter |
| AGAMOUSATCONSENSUS | TTDCCWWWWWWGGHAA | 16 | Stress | Drought | Arabidopsis thaliana | Binding consensus sequence of Arabidopsis (A.t.) AGAMOUS MADS domain |
| AGATCONSENSUS | TTWCCWWWWNNGGWW | 15 | Development | Flower | Arabidopsis (Arabidopsis thaliana) | Binding consensus sequence for the product of the Arabidopsis (A.t.) floral homeotic gene AGAMOUS (AG) |
| AGCBOXNPGLB | AGCCGCC | 7 | Hormone | Ethylene | tobacco (Nicotiana plumbaginifolia); Arabidopsis (Arabidopsis thaliana); tobacco (Nicotiana sylvestris); Oryza sativa; rice; | AGC box repeated twice in a 61 bp enhancer element in tobacco (N.p.) class I beta-1,3-glucanase (GLB) gene |
| AGL1ATCONSENSUS | NTTDCCWWWWNNGGWAAN | 18 | Light | Light | Arabidopsis thaliana | Binding consensus sequence of Arabidopsis (A.t.) AGL1 (AGAMOUS-like 1) |
| AGL2ATCONSENSUS | NNWNCCAWWWWTRGWWAN | 18 | Development | Flower | Arabidopsis thaliana | Binding consensus sequence of Arabidopsis (A.t.) AGL2 (AGAMOUS-like 2) |
| AGL3ATCONSENSUS | TTWCYAWWWWTRGWAA | 16 | Development | Flower | Arabidopsis thaliana | Binding consensus sequence of Arabidopsis(A.t.) AGL3 |
| AGMOTIFNTMYB2 | AGATCCAA | 8 | Stress | Drought | Nicotiana tabacum (tobacco) | AG-motif found at -114 of the promoter of NtMyb2 gene |
| AGTACSAO | AAAAAGTAAAAAGTAAAAAAGTAAAAAG | 28 | Unclassified | Unclassified | pumpkin (Cucurbita sp.) | AGTA repeat in pumpkin (C.s.) ascorbate oxidase gene (AO) promoter |
| ALF1NTPARC | TTACGCAAGCAATGACA | 17 | Hormone | Auxin | tobacco (Nicotiana tabacum); | ALF-1 (as-1-like sequence binding factor) binding site found in tobacco (N.t.) parC gene |
| ALF2NTPARB | TGAGGAGACTTGTGAGGT | 18 | Hormone | Auxin | tobacco (Nicotiana tabacum); | ALF-2 (as-1-like sequence binding factor 2) binding site found in tobacco (N.t.) parB gene |
| AMMORESIIUDCRNIA1 | GGWAGGGT | 8 | Metabolism | Metabolism | Chlamydomonas reinhardtii | Motifs (IIU and IID) found in the Chlamydomonas (C.R.) Nia1 gene promoter |
| AMMORESIVDCRNIA1 | CGAACTT | 7 | Metabolism | Metabolism | Chlamydomonas reinhardtii | Motif (IVD) found in the Chlamydomonas (C.R.) Nia1 gene promoter |
| AMMORESVDCRNIA1 | GGCCCCGGG | 9 | Metabolism | Metabolism | Chlamydomonas reinhardtii | Motif (VD) found in the Chlamydomonas (C.R.) Nia1 gene promoter |
| AMYBOX1 | TAACARA | 7 | Development | Seed | barley (Hordeum vulgare); rice (Oryza sativa); wheat (Triticum aestivum) | amylase box |
| AMYBOX2 | TATCCAT | 7 | Development | Seed | barley (Hordeum vulgare); rice (Oryza sativa); wheat (Triticum aestivum) | amylase box |
| ANAERO1CONSENSUS | AAACAAA | 7 | Stress | Anoxic | Zea mays (maize); Arabidopsis thaliana; Pisum sativum (pea); Hordeum vulgare (barley); Oryza sativa (rice); Petunia hybrida (petunia); Lycopersicon esculentum (tomato); | One of 16 motifs found in silico in promoters of 13 anaerobic genes involved in the fermentative pathway (anaerobic set |
| ANAERO2CONSENSUS | AGCAGC | 6 | Stress | Anoxic | Zea mays (maize); Arabidopsis thaliana; Pisum sativum (pea); Hordeum vulgare (barley); Oryza sativa (rice); Petunia hybrida (petunia); Lycopersicon esculentum (tomato); | One of 16 motifs found in silico in promoters of 13 anaerobic genes involved in the fermentative pathway (anaerobic set |
| ANAERO3CONSENSUS | TCATCAC | 7 | Stress | Anoxic | Zea mays (maize); Arabidopsis thaliana; Pisum sativum (pea); Hordeum vulgare (barley); Oryza sativa (rice); Petunia hybrida (petunia); Lycopersicon esculentum (tomato); | One of 16 motifs found in silico in promoters of 13 anaerobic genes involved in the fermentative pathway (anaerobic set |
| ANAERO4CONSENSUS | GTTTHGCAA | 9 | Stress | Anoxic | Zea mays (maize); Arabidopsis thaliana; Pisum sativum (pea); Hordeum vulgare (barley); Oryza sativa (rice); Petunia hybrida (petunia); Lycopersicon esculentum (tomato); | One of 16 motifs found in silico in promoters of 13 anaerobic genes involved in the fermentative pathway (anaerobic set |
| ANAERO5CONSENSUS | TTCCCTGTT | 9 | Stress | Anoxic | Zea mays (maize); Arabidopsis thaliana; Pisum sativum (pea); Hordeum vulgare (barley); Oryza sativa (rice); Petunia hybrida (petunia); Lycopersicon esculentum (tomato); | One of 16 motifs found in silico in promoters of 13 anaerobic genes involved in the fermentative pathway (anaerobic set |
| ANAEROBICCISZMGAPC4 | CGAAACCAGCAACGGTCCAG | 20 | Stress | Anoxic | maize (Zea mays) | 20 bp anaerobic cis-regulatory sequence found in the maize (Z.m.) GapC4 (Glyceraldehyde-3-phosphate dehydrogenase 4) gen |
| ARE1 | RGTGACNNNGC | 11 | Stress | Oxidative | rat | ARE (antioxidant response element) |
| ARECOREZMGAPC4 | AGCAACGGTC | 10 | Stress | Drought | maize (Zea mays) | Putative binding site for a Myb found in the promoter of maize glycolytic glyceraldehyde-3-phospate dehydrogenase 4 (Gap |
| ARELIKEGHPGDFR2 | AGTTGAATGGGGGTGCA | 17 | Stress | Drought | Gerbera hybrida (Astraceae); Zea mays (maize) | Sequence highly similar to ARE (anthocyanin regulatory element) found in maize anthocyanin promoter (Tuerck and Fromm 19 |
| ARFAT | TGTCTC | 6 | Hormone | Auxin | Arabidopsis thaliana; Soybean (Glycine max); Oryza sativa (rice) | ARF (auxin response factor) binding site found in the promoters of primary/early auxin response genes of Arabidopsis tha |
| ARR1AT | NGATT | 5 | Hormone | Cytokinin | Arabidopsis thaliana | ARR1-binding element found in Arabidopsis |
| AS1CAMV | CCACTGACGTAAGGGATGACGCACAATCC | 29 | Development | Root | Cauliflower mosaic virus; CaMV; | as-1 (activation sequence 1) in CaMV 35S promoter |
| AS1LIKECSHPRA | AAATGACGAAAATGC | 15 | Hormone | Cytokinin | cucumber (Cucumis sativus) | as-1-like motif found in cucumber (C.s.) hydroxypyruvate reductase (hprA) gene |
| ASF1ATNOS | TGAGCTAAGCACATACGTCAG | 21 | Hormone | Auxin | Agrobacterium tumefaciens | Tobacco ASF-1 binding site in nopaline synthase (NOS) promoter of Ti-plasmid of Agrobacterium tumefaciens (A.t.) |
| ASF1MOTIFCAMV | TGACG | 5 | Light | Light | CaMV; Cauliflower mosaic virus; plant; tobacco (Nicotiana tabacum); Arabidopsis thaliana; | ASF-1 binding site in CaMV 35S promoter |
| ASF1NTPARA | TTACGCAAGCAATGACAT | 18 | Hormone | Auxin | tobacco (Nicotiana tabacum); | ASF-1 (as-1 binding nuclear factor) binding site found in tobacco (N.t.) parA gene |
| AT1BOX | AATATTTTTATT | 12 | Light | Light | pea (Pisum sativum); tobacco (Nicotiana plumbaginifolia); tomato (Lycopersicon esculentum); | AT-1 box (AT-rich element) found in the promoter region of the genes for tobacco ( N.p.) chlorophyll a/b binding protein |
| ATHB1ATCONSENSUS | CAATWATTG | 9 | Unclassified | Unclassified | Arabidopsis thaliana | Recognition sequence of Arabidopsis Athb-1 protein |
| ATHB2ATCONSENSUS | CAATSATTG | 9 | Unclassified | Unclassified | Arabidopsis thaliana | Recognition sequence of Arabidopsis Athb-2 protein |
| ATHB5ATCORE | CAATNATTG | 9 | Unclassified | Unclassified | Arabidopsis thaliana | Consensus binding sequence for Arabidopsis (A.T.) class I HDzip (Homeodomein-leucine zipper) protein, ATHB5 |
| ATHB6COREAT | CAATTATTA | 9 | Metabolism | Metabolism | Arabidopsis thaliana | Consensus binding sequence for Arabidopsis (A.T.) homeodomain-leucine zipper protein, ATHB6 |
| ATRICHPSPETE | AATATACTAGTATTATTTACTAAAAAAAATC | 31 | Common | Common | pea (Pisum sativum) | A/T-rich sequences found in pea (P.s.) plastocyanin gene (petE) promoter |
| AUXREPSIAA4 | KGTCCCAT | 8 | Hormone | Auxin | pea (Pisum sativum) | AuxRE (Auxine responsive element ) of pea (P.s.) PS-IAA4/5 gene |
| AUXRETGA1GMGH3 | TGACGTAA | 8 | Hormone | Auxin | soybean (Glycine max) | TGA-box #1 in putative auxin-resonsive element (AUXRE) of soybean (G.m.) GH3 promoter |
| AUXRETGA2GMGH3 | TGACGTGGC | 9 | Hormone | Auxin | soybean (Glycine max) | TGA-box #2 in putative auxin-resonsive element (AUXRE) E1 of soybean (G.m.) GH3 promoter |
| B2GMAUX28 | CTTGTCGTCA | 10 | Hormone | Auxin | soybean (Glycine max) | B2 |
| BBOXSITE1STPAT | GCTAAACAAT | 10 | Metabolism | Metabolism | Solanum tuberosum (potato) | 10 base pair motif (site 1) within the B-box found in the potato patatin gene promoter |
| BIHD1OS | TGTCA | 5 | TF | TF | Oryza sativa (rice) | Binding site of OsBIHD1, a rice BELL homeodomain transcription factor |
| BOX1PSGS2 | ATAGAAATCAA | 11 | Unclassified | Unclassified | pea (Pisum sativum) | Box 1 element in pea (P.s.) glutamine synthetase (GS2) gene |
| BOX1PVCHS15 | TAAAAGTTAAAAAC | 14 | Light | Light | bean (Phaseolus vulgaris) | Box 1 of bean (P.v.) chs15 promoter |
| BOX2PSGS2 | TCTAAGCAAAG | 11 | Unclassified | Unclassified | pea (Pisum sativum); | Box 2 in glutamine synthetase (GS2) gene in pea (P.s.) |
| BOX2PVCHS15 | CTGTGATTAAATAT | 14 | Unclassified | Unclassified | bean (Phaseolus vulgaris) | Box 2 of bean (P.v.) chs15 promoter |
| BOX3PVCHS15 | TATTGGTTACTAAA | 14 | Unclassified | Unclassified | bean (Phaseolus vulgaris) | Box 3 of bean (P.v.) chs15 promoter |
| BOXBPSAS1 | AAACGACACCGTTT | 14 | Light | Light | pea (Pisum sativum) | Box B in pea (P.s.) asparagine synthetase (AS1) gene |
| BOXC'PSAS1 | TCCCGGTACACACTTCTT | 18 | Light | Light | pea (Pisum sativum); | Box C' in pea asparagine synthetase (AS1) gene |
| BOXCPSAS1 | CTCCCAC | 7 | Light | Light | pea (Pisum sativum) | Box C in pea (P.s.) asparagine synthetase (AS1) gene |
| BOXICHS | GTCCMTCMAACCTAMC | 16 | Light | Light | parsley (Petroselinum crispum); mustard (Sinapis alba); | Box I consensus sequence in the promoters of mustard and parsley chs genes |
| BOXIINTPATPB | ATAGAA | 6 | Unclassified | Unclassified | tobacco (Nicotiana tabacum) | Box II found in the tobacco (N.t.) plastid atpB gene promoter |
| BOXIIPCCHS | ACGTGGC | 7 | Light | Light | parsley (Petroselinum crispum) | Core of Box II/G box found in the parsley (P.c.) chs genes |
| BOXINTPATPB | AATTCCATAGAATAGATAATA | 21 | Unclassified | Unclassified | tobacco (Nicotiana tabacum) | Box I found in the tobacco (N.t.) plastid atpB gene promoter |
| BOXLCOREDCPAL | ACCWWCC | 7 | Light | Light | Daucus carota (carrot) | Consensus of the putative core sequences of box-L-like sequences in carrot (D.c.) PAL1 promoter region |
| BP5OSWX | CAACGTG | 7 | Stress | Drought | Oryza sativa (rice); | OsBP-5 (a MYC protein) binding site in Wx promoter |
| BS1EGCCR | AGCGGG | 6 | Development | Meristem | Eucalyptus gunnii | BS1 (binding site 1) found in E. gunnii Cinnamoyl-CoA reductase (CCR) gene promoter |
| C1GMAUX28 | TGAAAACAGTGAGTTA | 16 | Hormone | Auxin | soybean (Glycine max) | C1 |
| C1MOTIFZMBZ2 | TAACTSAGTTA | 11 | Hormone | Ethylene | maize (Zea mays) | C1-motif |
| C2GMAUX28 | AATAATAATAATAATAAATA | 20 | Hormone | Auxin | soybean (Glycine max) | C2 |
| CAATBOX1 | CAAT | 4 | Development | Seed | pea (Pisum sativum) | CAAT promoter consensus sequence found in legA gene of pea |
| CAATBOX2 | GGCCAATCT | 9 | Common | Common | eukaryote; | CAAT box found in the 5' upstream region (-80) of many eukaryotic genes |
| CACGCAATGMGH3 | CACGCAAT | 8 | Hormone | Auxin | Soybean (Glycine max) | Sequence found in D4 element in Soybean (G.m.) GH3 gene promoter |
| CACGTGMOTIF | CACGTG | 6 | Light | Light | tomato (Lycopersicon esculentum); Arabidopsis thaliana; snapdragon (Antirrhinum majus); wheat (Triticum aestivum); parsley: maize (Zea mays); periwinkle (Catharanthus roseus); Brassica napus; bean (Phaseolus vulgaris); | CACGTG motif |
| CACTFTPPCA1 | YACT | 4 | Development | Meristem | Flaveria trinervia | Tetranucleotide (CACT) is a key component of Mem1 (mesophyll expression module 1) found in the cis-regulatory element in |
| CANBNNAPA | CNAACAC | 7 | Development | Seed | Brassica napus; | Core of (CA)n element in storage protein genes in Brasica napus (B.n.) |
| CAREOSREP1 | CAACTC | 6 | Hormone | Gibberellin | Oryza sativa (rice) | CAREs (CAACTC regulatory elements) found in the promoter region of a cystein proteinase (REP-1) gene in rice |
| CARG1ATAP3 | GTTTACATAAATGGAAAA | 18 | Development | Flower | Arabidopsis thaliana | CArG1 found in the Arabidopsis (A.t.) APETALA3 (AP3) gene promoter |
| CARG2ATAP3 | CTTACCTTTCATGGATTA | 18 | Development | Flower | Arabidopsis thaliana | CArG2 found in the Arabidopsis (A.t.) APETALA3 (AP3) gene promoter |
| CARG3ATAP3 | CTTTCCATTTTTAGTAAC | 18 | Development | Flower | Arabidopsis thaliana | CArG3 found in the Arabidopsis (A.t.) APETALA3 (AP3) gene promoter |
| CARGATCONSENSUS | CCWWWWWWGG | 10 | Stress | Cold | Arabidopsis thaliana | CArG consensus sequence found in the promoter of Arabidopsis (A.t.) SOC1 which is the MADS-box flowering-time gene |
| CARGCW8GAT | CWWWWWWWWG | 10 | Unclassified | Unclassified | Arabidopsis thaliana | A variant of CArG motif (see S000404), with a longer A/T-rich core |
| CARGNCAT | CCWWWWWWWWGG | 12 | Hormone | Auxin | Arabidopsis thaliana; | Noncanonical CArG motif (CC-Wx8-GG) found in the promoter region of DTA1 (AtGA2ox6) |
| CATATGGMSAUR | CATATG | 6 | Hormone | Auxin | soybean (Glycine max) | Sequence found in NDE element in soybean (G.m.) SAUR (Small Auxin-Up RNA) 15A gene promoter |
| CBFHV | RYCGAC | 6 | Stress | Cold | Hordeum vulgare (barley) | Binding site of barley (H.v.) CBF1, and also of barley CBF2 |
| CCA1ATLHCB1 | AAMAATCT | 8 | Light | Light | Arabidopsis thaliana; | CCA1 binding site |
| CCAATBOX1 | CCAAT | 5 | Stress | Heat | eukaryotes; Glycine max (Soybean) | Common sequence found in the 5'-non-coding regions of eukaryotic genes |
| CCTCGTGTCTCGMGH3 | CCTCGTGTCTC | 11 | Hormone | Auxin | Soybean (Glycine max) | Sequence found in D1 element in Soybean (G.m.) GH3 gene promoter |
| CDA1ATCAB2 | CAAAACGC | 8 | Light | Light | Arabidopsis thaliana | CDA-1 (CAB2 DET1-associated factor 1) binding site in DtRE (dark response element) f of chlorophyll a/b-binding protein2 |
| CE3OSOSEM | AACGCGTGTC | 10 | Hormone | ABA | rice (Oryza sativa) | CE3 (Coupling Element 3) found in the promoter of the rice (O.s.) Osem gene |
| CELLCYCLESC | CACGAAAA | 8 | Development | Cell cycle | yeast (Saccharomyces cerevisiae) | cell cycle box found in URS2 (-940/-200) of HO gene of S.cerevisiae |
| CEREGLUBOX1PSLEGA | TGTTAAAGT | 9 | Development | Seed | pea (Pisum sativum) | cereal glutenin box in pea legumin gene (legA) |
| CEREGLUBOX2PSLEGA | TGAAAACT | 8 | Development | Seed | pea (Pisum sativum) | cereal glutenin box in pea legumin gene (legA) |
| CEREGLUBOX3PSLEGA | TGTAAAAGT | 9 | Development | Seed | pea (Pisum sativum) | cereal glutenin box in pea (P.s.) legumin gene (legA) |
| CGACGOSAMY3 | CGACG | 5 | Unclassified | Unclassified | rice (Oryza sativa); | CGACG element found in the GC-rich regions of the rice (O.s.) Amy3D and Amy3E amylase genes, but not in Amy3E gene |
| CGCGBOXAT | VCGCGB | 6 | Unclassified | Unclassified | Arabidopsis thaliana | CGCG box recognized by AtSR1-6 (Arabidopsis thaliana signal-responsive genes) |
| CGF1ATCAB2 | GATAAAGATTACTTCAGATATAACAAACGTTAC | 33 | Development | Meristem | Arabidopsis thaliana; | CGF-1 binding site in the Arabidopsis (A.t.) cab2 gene promoter |
| CGTGTSPHZMC1 | CGTGTCGTCCATGCAT | 16 | Light | Light | maize (Zea mays) | Sequence found in the maize (Z.m.) C1 gene promoter |
| CIACADIANLELHC | CAANNNNATC | 10 | Circadian | Circadian | tomato (Lycopersicon esculentum) | Region necessary for circadian expression of tomato (L.e.) Lhc gene |
| CMSRE1IBSPOA | TGGACGG | 7 | Metabolism | Metabolism | Ipomoea batatas (sweet potato) | CMSRE-1 (Carbohydrate Metabolite Signal Responsive Element 1) found in the promoter of sweet potato (I.b.) sporamin A ge |
| CONSERVED11NTZMATP1 | ACGTATTAAAA | 11 | Unclassified | Unclassified | maize (Zea mays) | Conserved 11 nt sequence found in the maize (Z.m.) mitochondrial atp1 promoter |
| COREOS | AAKAATWYRTAWATAAAAMTTTTATWTA | 28 | Stress | Oxidative | Oryza sativa (rice) | CORE (coordinate regulatory element for antioxidant defense) conserved on the promoter regions of three antioxidant defe |
| CPBCSPOR | TATTAG | 6 | Light | Light | Cucumis sativus L. (cucumber) | The sequence critical for Cytokinin-enhanced Protein Binding in vitro, found in -490 to -340 of the promoter of the cucu |
| CPRFPCCHS | CCACGTGGCC | 10 | Light | Light | Parsley (Petroselinum crispum) | BoxII |
| CRTDREHVCBF2 | GTCGAC | 6 | Stress | Cold | Hordeum vulgare (barley) | Preferred sequence for AP2 transcriptional activator HvCBF2 of barley |
| CTRMCAMV35S | TCTCTCTCT | 9 | Common | Common | Cauliflower mosaic virus (CaMV) | CT-rich motif (inverted GAGA) found in a 60-nucleotide region (S1) downstream of the transcription start site of the CaM |
| CURECORECR | GTAC | 4 | Stress | Anoxic | Chlamydomonas reinhardtii | GTAC is the core of a CuRE (copper-response element) found in Cyc6 and Cpx1 genes in Chlamydomonas |
| CYTOSITECSHPRA | AAGATTGATTGAG | 13 | Light | Light | cucumber (Cucumis sativus) | 13 bp sequence of unknown function found in cucumber (C.s.) hydroxypyruvate reductase (hprA) gene promoter |
| D1GMAUX28 | ACAGTTACTA | 10 | Light | Light | soybean (Glycine max) | D1 |
| D2GMAUX28 | ATTTATATAAAT | 12 | Hormone | Auxin | soybean (Glycine max) | D2 |
| D3GMAUX28 | TATTTGCTTAA | 11 | Hormone | Auxin | soybean (Glycine max) | D3 |
| D4GMAUX28 | TAGTGCTGT | 9 | Hormone | Auxin | soybean (Glycine max) | D4 |
| DE1PSPRA2 | GGATTTTACAGT | 12 | Light | Light | pea (Pisum sativum) | DE1 found in the pea(P.S) pra2 gene promoter |
| DOFCOREZM | AAAG | 4 | Development | Endosperm | maize (Zea mays) | Core site required for binding of Dof proteins in maize (Z.m.) |
| DPBFCOREDCDC3 | ACACNNG | 7 | Hormone | ABA | carrot (Daucus carota); Arabidopsis thaliana; | A novel class of bZIP transcription factors, DPBF-1 and 2 (Dc3 promoter-binding factor-1 and 2) binding core sequence |
| DR5GMGH3 | CCTTTTGTCTC | 11 | Hormone | Auxin | Soybean (Glycine max) | DR5 |
| DRE1COREZMRAB17 | ACCGAGA | 7 | Stress | Drought | maize (Zea mays) | DRE1 core found in maize (Z.M.) rab17 gene promoter |
| DRE2COREZMRAB17 | ACCGAC | 6 | Stress | Drought | maize (Zea mays) | DRE2 core found in maize (Z.M.) rab17 gene promoter |
| DRECRTCOREAT | RCCGAC | 6 | Light | Light | Oryza sativa (rice); Zea mays (maize); Helianthus annuus (sunflower); | Core motif of DRE/CRT (dehydration-responsive element/C-repeat) cis-acting element found in many genes in Arabidopsis an |
| DREDR1ATRD29AB | TACCGACAT | 9 | Hormone | ABA | Arabidopsis thaliana; Populus spp.; | Related to responsiveness to drought, low-temperature or high-salt stress |
| E2F1OSPCNA | GCGGGAAA | 8 | Development | Meristem | rice (Oryza sativa); tobacco (Nicotiana tabacum) | re2f-1 found in the promoter of rice PCNA gene |
| E2FANTRNR | TTTCCCGC | 8 | Development | Cell cycle | tobacco (Nicotiana tabacum); Arabidopsis thaliana; | E2Fa element found in the tobacco (N.t.) RNR (Ribonucleotide reductase) gene promoter and in the Arabidopsis thaliana ( |
| E2FAT | TYTCCCGCC | 9 | Development | Cell cycle | Arabidopsis thaliana | E2F-binding site found in many potential E2F target genes |
| E2FBNTRNR | GCGGCAAA | 8 | TF | TF | tobacco (Nicotiana tabacum) | E2Fb found in the tobacco (N.t.) RNR (Ribonucleotide reductase) gene promoter |
| E2FCONSENSUS | WTTSSCSS | 8 | Hormone | Ethylene | Arabidopsis thaliana; Nicotiana tabacum (tobacco); Oryza sativa (rice); Nicotiana benthamiana; | E2F consensus sequence of all different E2F-DP-binding motifs that were experimentally verified in plants (Vandepoele et |
| EBOXBNNAPA | CANNTG | 6 | Hormone | ABA | Brassica napus; | E-box of napA storage-protein gene of Brassica napus (B.n.) |
| EECCRCAH1 | GANTTNC | 7 | Stress | Drought | Chlamydomonas reinhardtii | EEC |
| EIN3ATERF1 | GGATTCAAGGGGCATGTATCTTGAATCC | 28 | Hormone | Ethylene | Arabidopsis thaliana | EIN3 (Ethylene-insensitive 3) binding site found in the promoter of the Arabidopsis (A.t.) ERF1 (Ethylene-Response-Facto |
| ELEMENT1GMLBC3 | GATATATTAATATTTTATTTTATA | 24 | Development | Root | Soybean (Glycine max) | Element 1 found in the promoter of soybean (G.m.) leghaemoglobin lbc3 gene |
| ELEMENT2GMLBC3 | CTTAAATTATTTATTT | 16 | Development | Root | Soybean (Glycine max) | Element 2 found in the promoter of soybean (G.m.) leghaemoglobin lbc3 gene |
| ELRE1PCPAL1 | CTCCAACAAACCCCTTC | 17 | Light | Light | parsley (Petroselinum crispum) | One of two elicitor (ELRE) and light response elements (LRE) found in the parsley (P.c.) phenylalanine ammonia-lyase (PA |
| ELRE2PCPAL1 | ATTCTCACCTACCA | 14 | Light | Light | parsley (Petroselinum crispum) | One of two elicitor (ELRE) and light response elements (LRE) found in the parsley (P.c.) phenylalanine ammonia-lyase (PA |
| ELRECOREPCRP1 | TTGACC | 6 | Hormone | MeJA | Petroselinum crispum (parsley); Nicotiana tabacum (tobacco); | ElRE (Elicitor Responsive Element) core of parsley (P.c.) PR1 genes |
| ELRENTCHN50 | GGTCANNNAGTC | 12 | Stress | Defense | tobacco (Nicotiana tabacum); | Elicitor-responsive element (ElRE) |
| EMBP1TAEM | CACGTGGC | 8 | Hormone | ABA | wheat (Triticum aestivum); Arabidopsis thaliana; | Binding site of trans-acting factor EMBP-1 |
| EMHVCHORD | TGTAAAGT | 8 | Development | Endosperm | Hordeum vulgare (barley) | Endosperm motif (EM) found in the promoter of barley (H.v.) c-hordein gene |
| EREGCC | TAAGAGCCGCC | 11 | Hormone | Ethylene | tobacco (Nicotiana tabacum); Arabidopsis thaliana; | GCC box in ERE (ethylene responsive element) |
| ERELEE4 | AWTTCAAA | 8 | Hormone | Ethylene | tomato (Lycopersicon esculentum); carnation (Dianthus caryophyllus); Lycopersicon chilense; | ERE (ethylene responsive element) of tomato (L.e.) E4 and carnation GST1 genes |
| ESPASGL01 | ACATGTCATCATGT | 14 | Development | Endosperm | Avena sativa (oat) | ESP (endosperm specificity palindrome) element found in the promoter of oat (A.s.) globulin gene (AsGlo1) |
| EVENINGAT | AAAATATCT | 9 | Circadian | Circadian | Arabidopsis thaliana; Solanum melongena; | Evening element found 46 times in the promoters of 31 cycling genes in Arabidopsis thaliana (Harmer et al. 2000) |
| GADOWNAT | ACGTGTC | 7 | Hormone | ABA | Arabidopsis thaliana; | Sequence present in 24 genes in the GA-down regulated d1 cluster (106 genes) found in Arabidopsis seed germination |
| GAGA8HVBKN3 | GAGAGAGAGAGAGAGA | 16 | Unclassified | Unclassified | Hordeum vulgare (barley) | GA octodinucleotide repeat found in intron IV of the barley (H.v.) gene Bkn3 |
| GAGAGMGSA1 | GAGAGAGAGAGAGAGAGA | 18 | Light | Light | Glycine max (soybean) | GAGA element found in the promoter of the heme and chlorophyll synthesis gene Gsa1 in soybean (G.m.) |
| GARE1OSREP1 | TAACAGA | 7 | Hormone | Gibberellin | Oryza sativa (rice) | Gibberellin-responsive element (GARE) found in the promoter region of a cystein proteinase (REP-1) gene in rice |
| GARE2 | RTAACARANTCYGG | 14 | Hormone | Gibberellin | rice (Oryza sativa); barley (Hordeum vulgare); wheat (Triticum aestivum); | Putative gibberellin responsive element |
| GARE2OSREP1 | TAACGTA | 7 | Hormone | Gibberellin | Oryza sativa (rice) | Gibberellin-responsive element (GARE) found in the promoter region of a cystein proteinase (REP-1) gene in rice |
| GARE4HVEPB1 | GTAACAGAATGCTGG | 15 | Hormone | Gibberellin | barley (Hordeum vulgare) | GARE-4 found in the barley (H.v.) EPB-1 (cysteine proteinase) gene promoter |
| GAREAT | TAACAAR | 7 | Hormone | Gibberellin | Arabidopsis thaliana; | GARE (GA-responsive element) |
| GAREHVAMY1 | GGCCGATAACAAACTCCGGCC | 21 | Hormone | Gibberellin | barley (Hordeum vulgare) | GARE (gibberellic acid responsive element) of barley (H.v.) alpha-amylase gene (Amy 1/6-4) |
| GATABOX | GATA | 4 | Light | Light | CaMV; Cauliflower mosaic virus; Petunia hybrida (petunia); Arabidopsis thaliana; Oryza sativa (rice); | GATA box |
| GBOX10NT | GCCACGTGCC | 10 | Development | Seed | tobacco (Nicotiana tabacum) | One of 11 G-box sequences in tobacco (N.t.) |
| GBOXLERBCS | MCACGTGGC | 9 | Light | Light | tomato (Lycopersicon esculentum); Arabidopsis thaliana; | G box |
| GBOXPC | ACCACGTGGC | 10 | Light | Light | parsley (Petroselinum crispum) | G box |
| GBOXRELOSAMY3 | CTACGTGGCCA | 11 | Hormone | ABA | rice (Oryza sativa); | G box-related element found in Amy3D (amylase) promoter of rice (O.s.) |
| GBOXSORBCS1 | TCCACGTGGT | 10 | Development | Root | spinach (Spinacia oleracea) | G-box found in the spinach(S.O.) RBCS-1 gene promoter |
| GCAACREPEATZMZEIN | GCAACGCAAC | 10 | Stress | Drought | maize (Zea mays) | GCAAC repeat found in the 22bp recognition site for beta-1 factor in the promoter of beta-zein (prolamin type) gene of m |
| GCBP2ZMGAPC4 | GTGGGCCCG | 9 | Stress | Anoxic | maize (Zea mays) | Binding site of tobacco nuclear factor (GCBP-2) found in the maize (Z.m.) GapC4 (Glyceraldehyde-3-phosphate dehydrogenas |
| GCCCORE | GCCGCC | 6 | Hormone | MeJA | Arabidopsis thaliana; Lycopersicon esculentum (tomato); | Core of GCC-box found in many pathogen-responsive genes such as PDF1.2, Thi2.1, and PR4 |
| GCN4OSGLUB1 | TGAGTCA | 7 | Development | Seed | rice (Oryza sativa) | GCN4 motif found in GluB-1 gene in rice (O.s.) |
| GGTCCCATGMSAUR | GGTCCCAT | 8 | Hormone | Auxin | Soybean (Glycine max) | Sequence found in NDE element in Soybean (G.m.) SAUR (Small Auxin-Up RNA) 15A gene promoter |
| GLMHVCHORD | RTGASTCAT | 9 | Development | Seed | Hordeum vulgare (barley); Triticum aestivum (wheat); | GLM (GCN4-like motif) found in the promoter of barley (H.v.) B1- and c-hordein gene |
| GLUTAACAOS | AACAAACTCTAT | 12 | Development | Seed | rice (Oryza sativa) | glutelin common motif |
| GLUTEBOX1OSGT2 | ATATCATGAGTCACTTCA | 18 | Development | Seed | rice (Oryza sativa) | Box 1 of rice (O.s.) glutelin Gt2 gene family promoter regions |
| GLUTEBOX1OSGT3 | TATCTAGTGAGTCACTTCA | 19 | Development | Seed | rice (Oryza sativa); | Box 1 of rice (O.s.) glutelin Gt3 gene family promoter region |
| GLUTEBOX2OSGT2 | TCCGTGTACCA | 11 | Development | Seed | rice (Oryza sativa) | Box II of rice (O.s.) glutelin Gt2 gene family |
| GLUTEBOX2OSGT3 | CTTTTGTGTACCTTA | 15 | Development | Seed | rice (Oryza sativa); | Box 2 of rice (O.s.) glutelin Gt3 gene family promoter region |
| GLUTEBP1OS | AAGCAACACACAAC | 14 | Development | Seed | rice (Oryza sativa) | Glutelin BP-1 |
| GLUTEBP2OS | ATGCTCAATAGATATAAGT | 19 | Development | Seed | rice (Oryza sativa) | Glutelin BP-2 |
| GLUTECOREOS | CTTTCGTGTAC | 11 | Development | Seed | rice (Oryza sativa) | Core site required for binding of the trans-acting factor in the promoter region of rice (O.s.) glutelin (type 2 gluteli |
| GMHDLGMVSPB | CATTAATTAG | 10 | Development | Seed | soybean (Glycine max) | Binding site of the soybean homeodomein leucine zipper proteins (GmHdl56, GmHdl57) |
| GRAZMRAB17 | CACTGGCCGCCC | 12 | Development | Seed | maize (Zea mays) | GRA |
| GRAZMRAB28 | CATGCCGCC | 9 | Development | Seed | maize (Zea mays) | GRA |
| GREGIONNTPRB1B | TGGCGGCTCTTATCTCACGTGATG | 24 | Hormone | Ethylene | Tobacco (Nicotiana tabacum) | G region found in tobacco (N.t.) PRB-1b gene promoter |
| GT1CONSENSUS | GRWAAW | 6 | Light | Light | pea (Pisum sativum); oat (Avena sativa); rice (Oryza sativa); tobacco (Nicotiana tabacum); Arabidopsis thaliana; spinach (Spinacia oleracea); bean; | Consensus GT-1 binding site in many light-regulated genes, e.g., RBCS from many species, PHYA from oat and rice, spinach |
| GT1CORE | GGTTAA | 6 | Development | Meristem | pea (Pisum sativum); | Critical for GT-1 binding to box II of rbcS |
| GT1GMSCAM4 | GAAAAA | 6 | Stress | Salt | Glycine max (soybean) | GT-1 motif found in the promoter of soybean (Glycine max) CaM isoform, SCaM-4 |
| GT1MOTIFPSRBCS | KWGTGRWAAWRW | 12 | Development | Meristem | pea (Pisum sativum) | GT-1 motif |
| GT2OSPHYA | GCGGTAATT | 9 | Light | Light | rice (Oryza sativa); oat (Avena sativa); | GT-2 (a rice nuclear protein) binding site in a rice (O.s.) phyA promoter |
| GTGANTG10 | GTGA | 4 | Development | Pollen | tabacco(Nicotiana tabacum) | GTGA motif found in the promoter of the tobacco (N.t.) late pollen gene g10 which shows homology to pectate lyase and is |
| HBOXCONSENSUSPVCHS | CCTACCNNNNNNNCT | 15 | Light | Light | bean (Phaseolus vulgaris); tobacco; | H-box |
| HBOXPVCHS15 | CCTACCNNNNNNNCTNNNNA | 20 | Stress | Defense | bean (Phaseolus vulgaris) | Binding site of two bean protein factors, KAP-1 and KAP-2 |
| HDMOTIFPCPR2 | CTAATTGTTTA | 11 | Stress | Defense | parsley (Petroselinum crispum) | HD (homeodomain) protein target site in parsley (P.c.) pathogenesis-related protein 2 (PR2) |
| HDZIP2ATATHB2 | TAATMATTA | 9 | Light | Light | Arabidopsis thaliana | Binding site of the Arabidopsis (A.T.) homeobox gene (ATHB-2) found in its own promoter |
| HDZIPIIIAT | GTAATSATTAC | 11 | Unclassified | Unclassified | Arabidopsis thaliana | Ath b-9 HD-Zip (HD-Zip-9), a member of a small family of HD-Zip proteins (HD-ZIP III), in Arabidopsis recognize this seq |
| HEXAMERATH4 | CCGTCG | 6 | Development | Meristem | Arabidopsis thaliana; | hexamer motif of Arabidopsis thaliana (A.t.) histone H4 promoter |
| HEXAT | TGACGTGG | 8 | TF | TF | Arabidopsis thaliana | Hex motif |
| HEXMOTIFTAH3H4 | ACGTCA | 6 | Development | Meristem | wheat (Triticum aestivum); CaMV; Oryza sativa (rice); | hexamer motif found in promoter of wheat (T.a.) histone genes H3 and H4 |
| HSE | CTNGAANNTTCNAG | 14 | Stress | Heat | animal; plant; Drosophila; tomato (Lycopersicon peruvianum); | HSE (heat shock response element) |
| HSELIKENTACIDICPR1 | CNNGAANNNTTCNNG | 15 | Unclassified | Unclassified | tobacco (Nicotiana tabacum) | HSE-like motif in -56 region of acidic PR1 gene of tobacco (N.t.) |
| HSELIKENTGLN2 | AGGAATTCCT | 10 | Stress | Heat | tobacco (Nicotiana tabacum) | HSE-like sequence in 5' upstream region of beta-1,3-glucanase gene (GLN2) of tobacco (N.t.) |
| HSRENTHSR203J | CAAAATTTTGTA | 12 | Stress | Defense | Nicotiana tabacum (tobacco) | HSRE(HSR203 responsive element) in tobacco (N.t.) responsible for the marked induction of the HSR203J gene during the HR |
| HY5AT | TGACACGTGGCA | 12 | Light | Light | Arabidopsis thaliana | G box |
| IBOX | GATAAG | 6 | Light | Light | tomato (Lycopersicon esculentum); Arabidopsis thaliana; | I box |
| IBOXCORE | GATAA | 5 | Light | Light | unknown | I box |
| IBOXCORENT | GATAAGR | 7 | Light | Light | Nicotiana plumbaginifolia (tobacco) | I-box core motif in the CAMs (conserved DNA modular arrays) associated with light-responsive promoter regions |
| IBOXLSCMCUCUMISIN | AGATATGATAAAA | 13 | Unclassified | Unclassified | Cucumis melo L. (melon) | I-box-like sequence found in the region (from -254 to -215) of cucumisin (a subtilisin-like serine protease) in the frui |
| IDE1HVIDS2 | ATCAAGCATGCTTCTTGC | 18 | Development | Root | Hordeum vulgare (barley) | IDE1 (iron-deficiency-responsive element 1) found at -153/-136 of barley IDS2 (iron deficiency specific clone 2) gene pr |
| IDE2HVIDS2 | TTGAACGGCAAGTTTCACGCTGTCACT | 27 | Development | Root | Hordeum vulgare (barley) | IDE2 (iron-deficiency-responsive element 2) found at -262/-236 of barley IDS2 (iron deficiency specific clone 2) gene pr |
| IDRSZMFER1 | CACGAGSCCKCCAC | 14 | Unclassified | Unclassified | Zea mays (maize); Arabidopsis thaliana; | IDRS (Iron-Dependent Regulatory Sequence) found in maize and Arabidopsis ferritin genes (Fer1) |
| INRNTPSADB | YTCANTYY | 8 | Light | Light | tobacco (Nicotiana tabacum) | Inr (initiator) elements found in the tobacco psaDb gene promoter without TATA boxes |
| INTRONLOWER | TGCAGG | 6 | Unclassified | Unclassified | maize (Zea mays) | 3' intron-exon splice junctions |
| INTRONUPPER | MAGGTAAGT | 9 | Unclassified | Unclassified | maize (Zea mays) | 5' exon-intron splice junctions of plant introns |
| IRO2OS | CACGTGG | 7 | Development | Root | Oryza sativa (rice) | OsIRO2-binding core sequence |
| JASE1ATOPR1 | CGTCAATGAA | 10 | Hormone | MeJA | Arabidopsis thaliana | JASE1found in promoter of Arabidopsis thaliana 12-oxo-phytodienoic acid-10,11-reductase (OPR1) gene |
| JASE2ATOPR1 | CATACGTCGTCAA | 13 | Hormone | MeJA | Arabidopsis thaliana | JASE2found in promoter of Arabidopsis thaliana 12-oxo-phytodienoic acid-10,11-reductase (OPR1) gene |
| JERECRSTR | CTCTTAGACCGCCTTCTTTGAAAG | 24 | Hormone | MeJA | periwinkle(Catharanthus roseus) | JERE (jasmonate- and elicitor-responsive element) found in the periwinkle(C.R.) strictosidine synthase(Str) gene promote |
| L1BOXATPDF1 | TAAATGYA | 8 | Hormone | ABA | Arabidopsis thaliana; Gossypium spp (cotton); | L1 box found in promoter of Arabidopsis thaliana (A.t.) PROTODERMAL FACTOR1 (PDF1) gene |
| L1DCPAL1 | ATTCACCTACCC | 12 | Unclassified | Unclassified | Daucus carota (carrot) | L1 element, found in PAL1 promoter in carrot (Daucus carota), is a protoplastization (dilution) responsive element |
| L4DCPAL1 | AATCTCCAACCA | 12 | Light | Light | Daucus carota (carrot) | L4 element, found in PAL1 promoter in carrot (Daucus carota), is a UV-B responsive element |
| LBOXLERBCS | AAATTAACCAA | 11 | Development | Meristem | tomato (Lycopersicon esculentum); tobacco (Nicotiana tabacum); | L box |
| LEAFYATAG | CCAATGT | 7 | Development | Meristem | Oryza sativa (rice); Arabidopsis thaliana; | Target sequence of LEAFY in the intron of AGAMOUS gene in Arabidopsis |
| LECPLEACS2 | TAAAATAT | 8 | Hormone | Ethylene | Lycopersicon esculentum (tomato) | Core element in LeCp (tomato Cys protease) binding cis-element (from -715 to -675) in LeAcs2 gene |
| LEGUMINBOXLEGA5 | TCCATAGCCATGCAWRCTGMAGAATGTC | 28 | Development | Seed | pea (Pisum sativum); tobacco (Nicotiana tabacum); Vicia faba; | legumin box in legA 5' legumin gene promoter in legumin |
| LREBOX2PSRBCS3 | TGTGTGGTTAATATG | 15 | Light | Light | pea (Pisum sativum); Arabidopsis thaliana; | LRE (light-responsive element) Box II of pea (P.s.) rbcS-3A gene |
| LREBOX3PSRBCS3 | ACTATTTTCACTATC | 15 | Light | Light | pea (Pisum sativum) | LRE (light-responsive element) Box III of pea (P.s.) rbcS-3A gene |
| LREBOXIIPCCHS1 | TCCACGTGGC | 10 | Light | Light | parsley (Petroselinum crispum) | BoxII |
| LREBOXIPCCHS1 | AACCTAACCT | 10 | Light | Light | parsley (Petroselinum crispum) | BoxI |
| LRENPCABE | ACGTGGCA | 8 | Light | Light | tobacco (Nicotiana plumbaginifolia) | LRE |
| LS5ATPR1 | TCTACGTCAC | 10 | Hormone | Auxin | Arabidopsis thaliana; tobacco (Nicotiana tabacum); | LS5 |
| LS7ATPR1 | ACGTCATAGA | 10 | Hormone | Auxin | Arabidopsis thaliana; tobacco (Nicotiana tabacum); | LS7 |
| LTRE1HVBLT49 | CCGAAA | 6 | Stress | Cold | barley (Hordeum vulgare) | LTRE-1 (low-temperature-responsive element) in barley (H.v.) blt4.9 gene promoter |
| LTREATLTI78 | ACCGACA | 7 | Stress | Cold | Arabidopsis thaliana; barley (Hordeum vulgare); | Putative low temperature responsive element (LTRE) |
| LTRECOREATCOR15 | CCGAC | 5 | Light | Light | Arabidopsis thaliana; Brassica napus | Core of low temperature responsive element (LTRE) of cor15a gene in Arabidopsis (A.t.) |
| MARABOX1 | AATAAAYAAA | 10 | Unclassified | Unclassified | Drosophila; fly; | A-box found in SAR(scaffold attachment region |
| MARARS | WTTTATRTTTW | 11 | Unclassified | Unclassified | yeast | ARS element |
| MARCEN3 | TGTTTWTGNTTTCCGAAANNNNWWW | 25 | Hormone | Ethylene | yeast | CEN III element |
| MARTBOX | TTWTWTTWTT | 10 | Unclassified | Unclassified | Drosophila; fly; | T-Box |
| MEJARELELOX | GATACANNAATNTGATG | 17 | Hormone | MeJA | tomato (Lycopersicon esculentum); | MeJa-responsive element (MeJaRE) in tomato (L. e.) lipoxygenase (LOX) gene |
| MNF1ZMPPC1 | GTGCCCTT | 8 | Light | Light | maize (Zea mays) | MNF1 binding site in maize (Z.m.) Ppc1 (phosphoenolpyruvate carboxylase) gene promoter |
| MREATCHS | TCTAACCTACCA | 12 | Light | Light | Arabidopsis thaliana | MREAtCHS (MRE = Myb Recognition Element) found in the LRU (light-responsive unit) in Arabidopsis (A.t.) chalcone synthas |
| MRNA3ENDTAH3 | AATGGAAATG | 10 | Development | Meristem | wheat (Triticum aestivum); yeast; | Cis element in 3' end region of wheat (T.a.) histone H3 mRNA |
| MRNASTA1CRPSBD | CUCUUTGUTTUU | 12 | Unclassified | Unclassified | Chlamydomonas reinhardtii | mRNA stability determinant found in 5'-UTR of psbD mRNA of Chlamydomonas reinhardtii (C.r.) |
| MRNASTA2CRPSBD | UGAGUUG | 7 | Unclassified | Unclassified | Chlamydomonas reinhardtii | mRNA stability determinant found in 5'-UTR of psbD mRNA of Chlamydomonas reinhardtii (C.r.) |
| MSACRCYM | AGACCGTTG | 9 | Development | Meristem | Catharanthus roseus | MSA (M-specific activator) motif in Catharanthus roseus (C.r.) B-type cyclin (CYM) promoter |
| MYB1AT | WAACCA | 6 | Hormone | ABA | Arabidopsis thaliana | MYB recognition site found in the promoters of the dehydration-responsive gene rd22 and many other genes in Arabidopsis |
| MYB1LEPR | GTTAGTT | 7 | Stress | Drought | Arabidopsis thaliana; Lycopersicon esculentum (tomato); | Tomato Pti4(ERF) regulates defence-related gene expression via GCC box and non-GCC box cis elements (Myb1(GTTAGTT), G bo |
| MYB26PS | GTTAGGTT | 8 | Stress | Drought | pea (Pisum sativum) | Myb26 binding site |
| MYB2AT | TAACTG | 6 | Stress | Drought | Arabidopsis thaliana; | Binding site for ATMYB2, an Arabidopsis MYB homolog |
| MYB2CONSENSUSAT | YAACKG | 6 | Hormone | ABA | Arabidopsis thaliana | MYB recognition site found in the promoters of the dehydration-responsive gene rd22 and many other genes in Arabidopsis |
| MYBATRD22 | CTAACCA | 7 | Hormone | ABA | Arabidopsis thaliana | Binding site for MYB (ATMYB2) in dehydration-responsive gene, rd22 |
| MYBCORE | CNGTTR | 6 | Stress | Drought | Arabidopsis thaliana; animal; petunia (Petunia hybrida); | Binding site for all animal MYB and at least two plant MYB proteins ATMYB1 and ATMYB2, both isolated from Arabidopsis |
| MYBCOREATCYCB1 | AACGG | 5 | Stress | Drought | Arabidopsis thaliana | Myb core in the 18 bp sequence which is able to activate reporter gene without leading to M-phase-specific expression, f |
| MYBGAHV | TAACAAA | 7 | Hormone | Gibberellin | barley (Hordeum vulgare); rice (Oryza sativa); | Central element of gibberellin (GA) response complex (GARC) in high-pI alpha-amylase gene in barley (H.v.) |
| MYBPLANT | MACCWAMC | 8 | Stress | Drought | snapdragon (Antirrhinum majus); bean (Phaseolus vulgaris); petunia (Petunia hybrida); Arabidopsis thaliana; maize (Zea mays); parsley (Petroselinum crispum); | Plant MYB binding site |
| MYBPZM | CCWACC | 6 | Stress | Drought | maize (Zea mays); | Core of consensus maize P (myb homolog) binding site |
| MYBST1 | GGATA | 5 | Stress | Drought | potato (Solanum tuberosum); | Core motif of MybSt1 (a potato MYB homolog) binding site |
| MYCATERD1 | CATGTG | 6 | Stress | Drought | Arabidopsis thaliana | MYC recognition sequence (from -466 to -461) necessary for expression of erd1 (early responsive to dehydration) in dehyd |
| MYCATRD22 | CACATG | 6 | Hormone | ABA | Arabidopsis thaliana | Binding site for MYC (rd22BP1) in Arabidopsis (A.t.) dehydration-resposive gene, rd22 |
| MYCCONSENSUSAT | CANNTG | 6 | Hormone | ABA | Arabidopsis thaliana | MYC recognition site found in the promoters of the dehydration-responsive gene rd22 and many other genes in Arabidopsis |
| NAPINMOTIFBN | TACACAT | 7 | Development | Seed | rape (Brassica napus) | Sequence found in 5' upstream region (-6, -95, -188) of napin (2S albumin) gene in Brassica napus (B.n.) |
| NDEGMSAUR | CCATATGCCATGTCTCTCAATTGGTCCCAT | 30 | Hormone | Auxin | Soybean (Glycine max) | NDE found in Soybean (G.m.) SAUR (Small Auxin-Up RNA) 15A gene promoter |
| NODCON1GM | AAAGAT | 6 | Development | Root | Glycine max (soybean) | One of two putative nodulin consensus sequences |
| NODCON2GM | CTCTT | 5 | Development | Root | Glycine max (soybean) | One of two putative nodulin consensus sequences |
| NONAMERATH4 | AGATCGACG | 9 | Development | Meristem | Arabidopsis thaliana; | Nonamer motif of Arabidopsis thaliana (A.t.) histone H4 promoter |
| NONAMERMOTIFTAH3H4 | CATCCAACG | 9 | Development | Meristem | wheat (Triticum aestivum); CaMV; | Nonamer motif found in promoter of wheat (T.a.) histone genes H3 and H4 |
| NRRBNEXTA | TAGTGGAT | 8 | Development | Root | Brassica napus | NRR (negative regulatory region) in promoter region of Brassica napus (B.n.) extA extensin gene |
| NTBBF1ARROLB | ACTTTA | 6 | Hormone | Auxin | Agrobacterium rhizogenes | NtBBF1(Dof protein from tobacco) binding site in Agrobacterium rhizogenes (A.r.) rolB gene |
| O2F1BE2S1 | TCCACGTCGA | 10 | Development | Seed | Brazil nut tree (Bertholletia excelsa); | opaque-2 recognition site F1 in Bertholletia excelsa (Brazil nut tree) 2S storage protein gene (be2S1) |
| O2F2BE2S1 | GCCACCTCAT | 10 | Development | Seed | Brazil nut tree (Bertholletia excelsa) | opaque-2 recognition site F2 in Bertholletia excelsa (Brazil nut tree) 2S storage protein gene (be2S1) |
| O2F3BE2S1 | TCCACGTACT | 10 | Development | Seed | Brazil nut tree (Bertholletia excelsa) | opaque-2 recognition site F3 in Bertholletia excelsa (Brazil nut tree) 2S storage protein gene (be2S1) |
| OBF5ATGST6 | ATCTTATGTCATTGATGACGACCTCC | 26 | Hormone | Auxin | Arabidopsis (Arabidopsis thaliana) | OBF5 (ocs element binding factor 5) binding site found in the Arabidopsis (A.t.) GST6 gene promoter |
| OBP1ATGST6 | TACACTTTTGG | 11 | Hormone | Auxin | Arabidopsis (Arabidopsis thaliana) | OBP1, 4, and 5 (OBF binding protein) binding site found in the Arabidopsis (A.t.) GST6 gene promoter |
| OCETYPEIIINTHISTONE | GATCCGCGNNNNNNNNNNNNNNACCAATCS | 30 | Development | Meristem | tobacco (Nicotiana tabacum) | Type III element |
| OCETYPEIINTHISTONE | TCACGCGGATC | 11 | Development | Meristem | tobacco (Nicotiana tabacum) | Type II element |
| OCETYPEINTHISTONE | CCACGTCANCGATCCGCG | 18 | Development | Meristem | tobacco (Nicotiana tabacum) | Type I element |
| OCSELEMENTAT | TGACGYAAGSRMTKACGYMM | 20 | Unclassified | Unclassified | Agrobacterium tumefaciens; tobacco; Arabidopsis thaliana; | OCS element in octopine synthase gene (OCS) of Ti-plasmid of Agrobacterium (A.t.) |
| OCSENHANMOTIFAT | ACGTAAGCGCTTACGT | 16 | TF | TF | Agrobacterium tumefaciens; tobacco (Nicotiana tabacum); maize (Zea mays); | OCS enhancer element in octopine synthase gene (OCS) of Ti-plasmid of Agrobacterium tumefaciens (A.t.) |
| OCSGMGH24 | CGGTTTACGTAATCTCTTACATCA | 24 | Hormone | Auxin | Soybean (Glycine max) | OCS element found in the soybean (G.m) GH2/4 gene promoter |
| OCSGMHSP26A | TGATGTAAGAGATTACGTAA | 20 | Stress | Heat | Soybean (Glycine max) | Ocs element found in soybean (Glycine max) heat shock gene (Gmhsp26-A) promoter |
| OCTAMERMOTIFTAH3H4 | CGCGGATC | 8 | Development | Meristem | wheat (Triticum aestivum); maize (Zea mays); CaMV; Arabidopsis thaliana; tobacco (Nicotiana tabacum); | Octamer motif found in promoter of wheat (T.a.) histone genes H3 and H4, and corn histone genes H3 and H4 |
| OCTAMOTIF2 | CGCGGCAT | 8 | Development | Meristem | maize (Zea mays); | Octamer motif found in histone-gene-specific consensus sequences |
| OPAQUE2ZM22Z | TCCACGTAGA | 10 | Development | Seed | maize (Zea mays) | Opaque-2 (O2) target sequence in maize (Z.m.) 22- and 27-kD zein promoters |
| OPAQUE2ZMB32 | GATGAYRTGG | 10 | Hormone | Gibberellin | maize (Zea mays) | opaque-2 binding site of maize (Z.m.) b-32 (type I ribosome-inactivating protein gene |
| OSE1ROOTNODULE | AAAGAT | 6 | Development | Root | Vicia faba; Medicago truncatula; Glycine max; Sesbania rostrata; | One of the consensus sequence motifs of organ-specific elements (OSE) characteristic of the promoters activated in infec |
| OSE2ROOTNODULE | CTCTT | 5 | Development | Root | Vicia faba; Medicago truncatula; Glycine max; Sesbania rostrata; | One of the consensus sequence motifs of organ-specific elements (OSE) characteristic of the promoters activated in infec |
| P1BS | GNATATNC | 8 | Stress | Drought | Arabidopsis thaliana; Lycopersicon esculentum (tomato); Medicago truncatula; Hordeum vulgare (barley); | PHR1-binding sequence found in the upstream regions of phosphate starvation responsive genes from several plant species |
| PALBOXAPC | CCGTCC | 6 | Light | Light | parsley (Petroselinum crispum) | Box A |
| PALBOXLPC | YCYYACCWACC | 11 | Light | Light | parsley (Petroselinum crispum) | Box L |
| PALBOXPPC | YTYYMMCMAMCMMC | 14 | Light | Light | parsley (Petroselinum crispum) | Box P |
| PALINDROMICCBOXGM | TGACGTCA | 8 | Unclassified | Unclassified | Glycine max(soybean); Arabidopsis thaliana | Palindromic C-box in soybean (G.m.) |
| PASNTPARA | TTACGCAAGCAATGACATCT | 20 | Unclassified | Unclassified | tobacco (Nicotiana tabacum) | pas |
| PE1ASPHYA3 | GAAATAGCAAATGTTAAAAATA | 22 | Light | Light | oat (Avena sativa); | PE1 |
| PE2FNTRNR1A | ATTCGCGC | 8 | Development | Cell cycle | Nicotiana tabacum (tobacco) | pE2F (proximal E2F elemen) at -143bp of tobacco (N.t.) RNR1a promoter |
| PE3ASPHYA3 | CAGCTCCCATGGCTCTCCCATCCGCGCCGGT | 31 | Light | Light | oat (Avena sativa); | PE3 |
| PIATGAPB | GTGATCAC | 8 | Light | Light | Arabidopsis thaliana | PI found in the Arabidopsis thaliana(A.T.) GAPB gene promoter |
| PIIATGAPB | TTGGTTTTGATCAAAACCAA | 20 | Light | Light | Arabidopsis thaliana | PII found in the Arabidopsis thaliana(A.T.) GAPB gene promoter |
| POLASIG1 | AATAAA | 6 | Unclassified | Unclassified | pea (Pisum sativum); rice (Oryza sativa); Arabidopsis thaliana; | PolyA signal |
| POLASIG2 | AATTAAA | 7 | Unclassified | Unclassified | rice (Oryza sativa); animal; | PolyA signal |
| POLASIG3 | AATAAT | 6 | Unclassified | Unclassified | maize (Zea mays) | Plant polyA signal |
| POLLEN1LELAT52 | AGAAA | 5 | Development | Pollen | Lycopersicon esculentum (tomato) | One of two co-dependent regulatory elements responsible for pollen specific activation of tomato (L.e.) lat52 gene |
| POLLEN2LELAT52 | TCCACCATA | 9 | Development | Pollen | tomato (Lycopersicon esculentum) | One of two co-dependent regulatory elements responsible for pollen specific activation of tomato (L.e.) lat52 gene |
| PR2GCNT | TAARAGCCGCC | 11 | Stress | Defense | tobacco (Nicotiana tabacum); | GC element conserved in the 5' upstream regions of group 2 PR protein genes (beta-1,3-glucanase (GLN2), chitinase (CHN17 |
| PREATPRODH | ACTCAT | 6 | TF | TF | Arabidopsis thaliana | PRE (Pro- or hypoosmolarity-responsive element) found in the promoter region of proline dehydrogenase (ProDH) gene in A |
| PRECONSCRHSP70A | SCGAYNRNNNNNNNNNNNNNNNHD | 24 | Light | Light | Chlamydomonas reinhardtii | Consensus sequence of PRE (plastid response element) in the promoters of HSP70A in Chlamydomonas |
| PREMOTIFNPCABE | ACCGGCCCACTT | 12 | Light | Light | tobacco (Nicotiana plumbaginifolia) | Motif sequence repeated many times in two positive regulatory elements, PRE1 (-1554 to -1182) and PRE2 (-747 to -516) fo |
| PROLAMINBOX | CACATGTGTAAAGGT | 15 | Development | Seed | rice (Oryza sativa); maize (Zea mays); barley (Hordeum vulgare); wheat (Triticum aestivum); | Prolamin Box |
| PROLAMINBOXOSGLUB1 | TGCAAAG | 7 | Development | Seed | rice (Oryza sativa) | Prolamine box found in the rice (O.s.) GluB-1 gene promoter |
| PROXBBNNAPA | CAAACACC | 8 | Hormone | ABA | Brassica napus | prox B (proximal portion of B-box) found in napA gene of Brassica napus (B.n.) |
| PSREGIONZMZM13 | TCGGCCACTATTTCTACGGGCAGCCAGACAAA | 32 | Development | Pollen | maize (Zea mays) | Pollen specific (PS) region in maize (Z.m.) ZM13 gene promoter |
| PYRIMIDINEBOXHVEPB1 | TTTTTTCC | 8 | Hormone | Gibberellin | barley (Hordeum vulgare) | Pyrimidine box found in the barley (H.v.) EPB-1 (cysteine proteinase) gene promoter |
| PYRIMIDINEBOXOSRAMY1A | CCTTTT | 6 | Hormone | Gibberellin | rice (Oryza sativa); barley (Hordeum vulgare); | Pyrimidine box found in rice (O.s.) alpha-amylase (RAmy1A) gene |
| QARBNEXTA | AACGTGT | 7 | Unclassified | Unclassified | Brassica napus | QAR (quantitative activator region) in promoter region of Brassica napus (B.n.) extA extensin gene |
| QELEMENTZMZM13 | AGGTCA | 6 | Development | Pollen | maize (Zea mays) | Q(quantitative)-element in maize (Z.m.) ZM13 gene promoter |
| RAV1AAT | CAACA | 5 | Hormone | ABA | Arabidopsis (Arabidopsis thaliana) | Binding consensus sequence of Arabidopsis (A.t.) transcription factor, RAV1 |
| RAV1BAT | CACCTG | 6 | Hormone | ABA | Arabidopsis (Arabidopsis thaliana) | Binding consensus sequence of an Arabidopsis (A.t.) transcription factor, RAV1 |
| RBCSBOX2PS | GTGTGGTTAATATG | 14 | Light | Light | pea (Pisum sativum) | rbcS box II |
| RBCSBOX3PS | ATCATTTTCACT | 12 | Development | Meristem | pea (Pisum sativum) | rbcS box III |
| RBCSCONSENSUS | AATCCAA | 7 | Development | Meristem | tomato (Lycopersicon esculentum); petunia (Petunia hybrida); tobacco (Nicotiana tabacum); pea (Pisum sativum); soybean (Glycine max); | rbcS general consensus sequence |
| RBCSGBOXPS | CACATGGCACT | 11 | Light | Light | pea (Pisum sativum); | rbcS G-box |
| RBENTGA3 | TCCAACTTGGA | 11 | Hormone | Gibberellin | tobacco (Nicotiana tabacum) | rbe (RSG binding element) found in the tobacco (N.t.) GA3 gene promoter |
| RE1ASPHYA3 | CATGGGCGCGG | 11 | Light | Light | oat (Avena sativa); pea (Pisum sativum); | RE1 (putative repressor element) responsible for Pfr-directed repression of oat (A.s.) phyA3 phytochrome gene |
| REALPHALGLHCB21 | AACCAA | 6 | Light | Light | Lemna gibba | REalpha found in Lemna gibba Lhcb21 gene promoter |
| REBETALGLHCB21 | CGGATA | 6 | Light | Light | Lemna gibba | REbeta found in Lemna gibba Lhcb21 gene promoter |
| REGION1OSOSEM | CGGCGGCCTCGCCACG | 16 | Hormone | ABA | rice (Oryza sativa) | region 1 ABRE-like sequence found in rice (O.s.) Osem gene promoter |
| RGATAOS | CAGAAGATA | 9 | Development | Meristem | rice (Oryza sativa); RTBV; rice tungro bacilliform virus; | R-GATA (GATA motif binding factor) binding site |
| RHERPATEXPA7 | KCACGW | 6 | Development | Root | Arabidopsis thaliana | Right part of RHEs (Root Hair-specific cis-Elements) conserved among the Arabidopsis thaliana A7 (AtEXPA7) orthologous ( |
| RNFG1OS | GATCATCGATC | 11 | Development | Meristem | rice (Oryza sativa); | RNFG1 binding site |
| RNFG2OS | CCAGTGTGCCCCTGG | 15 | Development | Meristem | rice (Oryza sativa); | RNFG2 binding site |
| ROOTMOTIFTAPOX1 | ATATT | 5 | Development | Root | Agrobacterium rhizogenes; | Motif found both in promoters of rolD |
| RSEPVGRP1 | CAACTTTCATAT | 12 | Development | Root | bean (Phaseolus vulgaris) | RSE (root-specific element) of bean (P.v.) GRP1.8 gene |
| RSEPVGRP18 | CATCCAACTTTCATATCCATGTGCTT | 26 | Development | Root | bean (Phaseolus vulgaris) | RSE (root-specific element) found in bean (P.V.) grp1.8 gene promoter |
| RSRBNEXTA | CAAACTCGTATATCCAT | 17 | Development | Root | Brassica napus | RSR (root specific region) in promoter region of Brassica napus (B.n.) extA extensin gene |
| RYREPEAT4 | TCCATGCATGCAC | 13 | Hormone | ABA | maize (Zea mays); wheat (Triticum aestivum); rice (Oryza sativa) | RY repeat motif |
| RYREPEATBNNAPA | CATGCA | 6 | Hormone | ABA | Brassica napus | RY repeat found in RY/G box (the complex containing the two RY repeats and the G-box) of napA gene in Brassica napus (B. |
| RYREPEATGMGY2 | CATGCAT | 7 | Development | Seed | soybean (Glycine max); | RY repeat motif (CATGCAT) |
| RYREPEATLEGUMINBOX | CATGCAY | 7 | Development | Seed | legume; soybean (Glycine max); | RY repeat (CATGCAY) or legumin box found in seed-storage protein genes in legume such as soybean (G.m.) |
| RYREPEATVFLEB4 | CATGCATG | 8 | Hormone | ABA | bean (Phaseolus vulgaris); soybean (Glycine max); Vicia faba; rice (Oryza sativa); Arabidopsis (Arabidopsis thaliana); | RY repeat motif |
| S1FBOXSORPS1L21 | ATGGTA | 6 | Development | Meristem | spinach (Spinacia oleracea) | S1F box conserved both in spinach (S.o.) RPS1 and RPL21 genes encoding the plastid ribosomal protein S1 and L21, respect |
| S1FSORPL21 | ATGGTATT | 8 | Development | Meristem | spinach (Spinacia oleracea) | S1F binding site (S1 site) in spinach (S.o.) RPL21 gene encoding the plastid ribosomal protein L21 |
| S2FSORPL21 | CCATACATT | 9 | Light | Light | spinach (Spinacia oleracea); | S2F binding site (S2 site) in spinach RPL21 gene encoding the plastid ribosomal protein L21 |
| SARECAMV | CTGACGTAAGGGATGACGCAC | 21 | Hormone | Salicylic acid | CaMV; Cauliflower mosaic virus; | Salicylic acid responsive element found in CaMV 35S promoter |
| SB1NPABC1 | CACTAACACAAAGTAA | 16 | Unclassified | Unclassified | Nicotiana plumbaginifolia (tobacco); | Sclareol box1 (SB1) found at -827 of a plasma membrane ATP binding cassette (ABC) transporter gene (NpABC1) in N. plumba |
| SB3NPABC1 | TTATGAACAGTAATT | 15 | Unclassified | Unclassified | Nicotiana plumbaginifolia (tobacco); | Sclareol box3 (SB3) found at -216 of a plasma membrane ATP binding cassette (ABC) transporter gene (NpABC1) in N. plumba |
| SBOXATRBCS | CACCTCCA | 8 | Unclassified | Unclassified | Arabidopsis thaliana | S-box conserved in several rbcS promoters in Arabidopsis |
| SE1PVGRP18 | ATAATGGGCCACACTGTGGGGCAT | 24 | Development | Meristem | bean (Phaseolus vulgaris) | SE1 (Stem element 1) found in the bean (P.v.) grp1.8 gene promoter |
| SE2PVGRP1 | TTNNNGTAGCTAGTGTATTTGTAT | 24 | Unclassified | Unclassified | bean (Phaseolus vulgaris) | SE2 (stem element 2) of bean (P.v.) GRP1.8 gene |
| SEBFCONSSTPR10A | YTGTCWC | 7 | Hormone | Auxin | Solanum tuberosum (potato) | Binding site of the potato silencing element binding factor (SEBF) gene found in promoter of pathogenesis-related gene ( |
| SEF1MOTIF | ATATTTAWW | 9 | Development | Seed | soybean (Glycine max) | SEF1 (soybean embryo factor 1) binding motif |
| SEF3MOTIFGM | AACCCA | 6 | Development | Seed | soybean (Glycine max); | SEF3 binding site |
| SEF4MOTIFGM7S | RTTTTTR | 7 | Development | Seed | soybean (Glycine max); | SEF4 binding site |
| SGBFGMGMAUX28 | TCCACGTGTC | 10 | Hormone | Auxin | soybean (Glycine max) | bZIP proteins SGBF-1 and SGBF-2 binding site in soybean (G.m.) GmAux28 gene promoter |
| SITE1SORPS1 | TCATGGTAACAATT | 14 | Light | Light | spinach (Spinacia oleracea); | Site 1 in the spinach (S.o.) rps1 promoter |
| SITE3SORPS1 | AGTTAGTTAAAAGA | 14 | Unclassified | Unclassified | spinach (Spinacia oleracea) | Site 3 of spinach (S.o.) rps1 promoter |
| SITEIIAOSPCNA | TGGGCCCGT | 9 | Hormone | Auxin | rice (Oryza sativa) | Site IIa of rice (O.s.) PCNA (proliferating cell nuclear antigen) gene |
| SITEIIATCYTC | TGGGCY | 6 | Stress | Oxidative | Arabidopsis thaliana; Oryza sativa (rice); | Site II element found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis |
| SITEIIBOSPCNA | TGGTCCCAC | 9 | Hormone | Auxin | rice (Oryza sativa) | Site IIb of rice PCNA (proliferating cell nuclear antigen) gene |
| SITEIOSPCNA | CCAGGTGG | 8 | Development | Meristem | rice (Oryza sativa) | Site I of rice (O.s.) PCNA (proliferating cell nuclear antigen) gene |
| SORLIP1AT | GCCAC | 5 | Light | Light | Arabidopsis thaliana | one of Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis |
| SORLIP2AT | GGGCC | 5 | Light | Light | Arabidopsis thaliana | one of Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis |
| SORLIP3AT | CTCAAGTGA | 9 | Light | Light | Arabidopsis thaliana | one of Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis |
| SORLIP4AT | GTATGATGG | 9 | Light | Light | Arabidopsis thaliana | one of Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis |
| SORLIP5AT | GAGTGAG | 7 | Light | Light | Arabidopsis thaliana | one of Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis |
| SORLREP2AT | ATAAAACGT | 9 | Light | Light | Arabidopsis thaliana | one of Sequences Over-Represented in Light-Repressed Promoters (SORLREPs) in Arabidopsis |
| SORLREP3AT | TGTATATAT | 9 | Light | Light | Arabidopsis thaliana | one of Sequences Over-Represented in Light-Repressed Promoters (SORLREPs) in Arabidopsis |
| SORLREP4AT | CTCCTAATT | 9 | Circadian | Circadian | Arabidopsis thaliana | one of Sequences Over-Represented in Light-Repressed Promoters (SORLREPs) in Arabidopsis |
| SORLREP5AT | TTGCATGACT | 10 | Light | Light | Arabidopsis thaliana | one of Sequences Over-Represented in Light-Repressed Promoters (SORLREPs) in Arabidopsis |
| SP8BFIBSP8AIB | ACTGTGTA | 8 | Development | Root | sweet potato (Ipomoea batatas); | One of SPBF binding site (SP8a) |
| SP8BFIBSP8BIB | TACTATT | 7 | Development | Root | sweet potato (Ipomoea batatas); | One of SPBF binding site (SP8b) |
| SPHCOREZMC1 | TCCATGCAT | 9 | Hormone | ABA | maize (Zea mays); | Core of Sph element |
| SPHZMC1 | CGTCCATGCAT | 11 | Light | Light | maize (Zea mays) | Sph element found in the maize (Z.m.) C1 gene promoter |
| SREATMSD | TTATCC | 6 | Unclassified | Unclassified | Arabidopsis thaliana | sugar-repressive element (SRE) found in 272 of the 1592 down-regulated genes after main stem decapitation in Arabidopsis |
| SRENTTTO1 | TGGTAGGTGAGAT | 13 | Hormone | MeJA | tobacco (Nicotiana tabacum) | Stress responsive element (SRE) in tobacco (N.t.) retrotransposon Tto1 |
| SURE1STPAT21 | AATAGAAAA | 9 | Development | Root | potato (Solanum tuberosum); | Sucrose Responsive Element (SURE) |
| SURE2STPAT21 | AATACTAAT | 9 | Development | Root | potato (Solanum tuberosum); | Sucrose Responsive Element 2 (SURE2) |
| SUREAHVISO1 | AAAACTAAGAAAGACCGATGGAAAA | 25 | Hormone | MeJA | Hordeum vulgare (barley) | SURE-a |
| SURECOREATSULTR11 | GAGAC | 5 | Hormone | Auxin | Arabidopsis thaliana | Core of sulfur-responsive element (SURE) found in the promoter of SULTR1 |
| SV40COREENHAN | GTGGWWHG | 8 | Common | Common | virus; plant; pea (Pisum sativum); Arabidopsis thaliana; | SV40 core enhancer |
| T/GBOXATPIN2 | AACGTG | 6 | Hormone | MeJA | Lycopersicon esculentum (tomato); Arabidopsis thaliana; | T/G-box found in tomato proteinase inhibitor II (pin2) and leucine aminopeptidase (LAP) genes |
| TAAAGSTKST1 | TAAAG | 5 | Unclassified | Unclassified | Solanum tuberosum (potato) | TAAAG motif found in promoter of Solanum tuberosum (S.t.) KST1 gene |
| TACBBFNTEAS4 | ACTCTACAGTACTC | 14 | Stress | Defense | tobacco (Nicotiana tabacum) | TacBBF (TAC box binding factor) binding site in tobacco (N.t.) 5-epi-aristolochene synthase (EAS4) gene |
| TATABOX1 | CTATAAATAC | 10 | Development | Seed | rice (Oryza sativa); bean (Phaseolus vulgaris); | TATA box |
| TATABOX2 | TATAAAT | 7 | Common | Common | pea (Pisum sativum); tobacco (Nicotiana tabacum); bean (Phaseolus vulgaris); | TATA box |
| TATABOX3 | TATTAAT | 7 | Common | Common | sweet potato (Ipomoea batatas); | TATA box |
| TATABOX4 | TATATAA | 7 | Common | Common | sweet potato (Ipomoea batatas); bean (Phaseolus vulgaris) | TATA box |
| TATABOX5 | TTATTT | 6 | Common | Common | pea (Pisum sativum); | TATA box |
| TATABOXOSPAL | TATTTAA | 7 | Unclassified | Unclassified | Oryza sativa (rice) | Binding site for OsTBP2, found in the promoter of rice pal gene encoding phenylalanine ammonia-lyase |
| TATAPVTRNALEU | TTTATATA | 8 | Stress | Drought | Phaseolus vulgaris; maize (Zea mays) | TATA-like motif |
| TATCCACHVAL21 | TATCCAC | 7 | Hormone | Gibberellin | barley (Hordeum vulgare) | TATCCAC box is a part of the conserved cis-acting response complex (GARC) that most often contain three sequence motifs, |
| TATCCAOSAMY | TATCCA | 6 | Hormone | Gibberellin | Oryza sativa (rice) | TATCCA element found in alpha-amylase promoters of rice (O.s.) at positions ca.90 to 150bp upstream of the transcription |
| TATCCAYMOTIFOSRAMY3D | TATCCAY | 7 | Unclassified | Unclassified | rice (Oryza sativa) | TATCCAY motif found in rice (O.s.) RAmy3D alpha-amylase gene promoter |
| TBOXATGAPB | ACTTTG | 6 | Light | Light | Arabidopsis thaliana | Tbox found in the Arabidopsis thaliana (A.T.) GAPB gene promoter |
| TCA1MOTIF | TCATCTTCTT | 10 | Hormone | Salicylic acid | barley (Hordeum vulgare); tobacco (Nicotiana tabacum); | TCA-1 (tobacco nuclear protein 1) binding site |
| TDBA12NTCHN50 | TGACTTTCTGAC | 12 | Hormone | MeJA | tobacco (Nicotiana tabacum) | TDBA12 binding site found in tobacco (N.t.) basic class I chitinase gene (CHN50) |
| TE2F2NTPCNA | ATTCCCGC | 8 | Development | Meristem | tobacco (Nicotiana tabacum) | te2f-2 found in the promoter of tobacco PCNA gene |
| TEF1BOXATA1 | ACAGGGGCATAATGGTAATTTAAA | 24 | Unclassified | Unclassified | Arabidopsis (Arabidopsis thaliana) | tef1 box found in the Arabidopsis (A.t.) EF-1 alpha A1 gene promoter |
| TEFBOXATEEF1AA1 | AGGGGCATAATGGTAA | 16 | Hormone | Ethylene | Arabidopsis (Arabidopsis thaliana) | tef-box found in the Arabidopsis (A.t.) eEF1AA1 gene promoter |
| TELOBOXATEEF1AA1 | AAACCCTAA | 9 | Hormone | Ethylene | Arabidopsis (Arabidopsis thaliana) | telo-box (telomere motif) found in the Arabidopsis (A.t.) eEF1AA1 gene promoter |
| TGA1ANTPR1A | CGTCATCGAGATGACG | 16 | Hormone | Auxin | tobacco (Nicotiana tabacum) | TGA1a binding site in tobacco (N.t.) PR1a gene |
| TGACGTVMAMY | TGACGT | 6 | Development | Seed | Vigna mungo | TGACGT motif found in the Vigna mungo (V.m.) alpha-Amylase (Amy) gene promoter |
| TGTCACACMCUCUMISIN | TGTCACA | 7 | Common | Common | Cucumis melo L. (melon) | TGTCACA motif found in the region (from -254 to -215) of cucumisin (a subtilisin-like serine protease) in the fruit of m |
| TL1ATSAR | CTGAAGAAGAA | 11 | Stress | Defense | Arabidopsis thaliana | TL1, a consensus sequence overrepresented in the promoter regions of all 13 NPR1-responsive ER-resident genes surveyed |
| TOPOISOM | GTNWAYATTNATNNG | 15 | Unclassified | Unclassified | fruit fly; Drosophila melanogaster; fly; | Topoisomerase cleavage site consensus sequence |
| TRANSINITDICOTS | AMNAUGGC | 8 | Unclassified | Unclassified | dicots; | Context sequence of translational initiation codon in dicots |
| TRANSINITMONOCOTS | RMNAUGGC | 8 | Unclassified | Unclassified | monocots; | Context sequence of translational initiation codon in monocots |
| TRANSTART | TAAACAATGGCT | 12 | Unclassified | Unclassified | rice (Oryza sativa); | plant consensus sequence for translation start site |
| UP1ATMSD | GGCCCAWWW | 9 | Unclassified | Unclassified | Arabidopsis thaliana | Up1 motif found in 162 of the 1184 up-regulated genes after main stem decapitation in Arabidopsis |
| UP2ATMSD | AAACCCTA | 8 | Unclassified | Unclassified | Arabidopsis thaliana | Up2 motif found in 193 of the 1184 up-regulated genes after main stem decapitation in Arabidopsis |
| UPRE1AT | ATTGGTCCACG | 11 | Unclassified | Unclassified | Arabidopsis thaliana | ERSEII-like sequence found in the plant UPRE (unfolded protein response element) in A.t. |
| UPRE2AT | CCACGTCATC | 10 | Unclassified | Unclassified | Arabidopsis thaliana | XBP1 binding site-like sequence found in the plant UPRE (unfolded protein response element) in A.t. |
| UPRMOTIFIAT | CCACGTCA | 8 | Stress | Heat | Arabidopsis thaliana | Motif I in the conserved UPR (unfolded protein response) cis-acting element in Arabidopsis genes coding for SAR1B, HSP-9 |
| UPRMOTIFIIAT | CCNNNNNNNNNNNNCCACG | 19 | Stress | Heat | Arabidopsis thaliana | Motif II in the conserved UPR (unfolded protein response) cis-acting element in Arabidopsis genes coding for SAR1B, HSP- |
| VOZATVPP | GCGTNNNNNNNACGC | 15 | Development | Pollen | Arabidopsis thaliana | VOZ-binding sequence found in the promoter of A. thaliana V-PPase (vacuolar H+-pyrophosphatase) gene |
| VSF1PVGRP18 | GCTCCGTTG | 9 | Development | Meristem | French bean (Phaseolus vulgaris); tomato (Lycopersicon esculentum); tobacco (Nicotiana tabacum); | VSF-1 binding site in French bean (P.v.) grp1.8 gene promoter |
| WARBNEXTA | GTACGTGTTATAAAACGTGT | 20 | Stress | Wound | Brassica napus | WAR (wounding activating region) in Brassica napus (B.n.) extA extensin gene |
| WBBOXPCWRKY1 | TTTGACY | 7 | Hormone | MeJA | Ipomoea batatas (sweet potato); Triticum aestivum (wheat); Hordeum vulgare (barley); Avena fatua (wild oat); Petroselium crispum (parsley); Arabidopsis thaliana; | WB box |
| WBOXATNPR1 | TTGAC | 5 | Hormone | MeJA | Arabidopsis thaliana | W-box found in promoter of Arabidopsis thaliana (A.t.) NPR1 gene |
| WBOXGACAD1A | AGTCAAAATTGACC | 14 | Hormone | MeJA | Gossypium arboreum (cotton) | W-box found in the promoter region of the CAD1-A (cotton (+) delta-cadinene synthase-A) gene (located in the region -340 |
| WBOXHVISO1 | TGACT | 5 | Hormone | MeJA | Hordeum vulgare (barley) | SUSIBA2 bind to W-box element in barley iso1 (encoding isoamylase1) promoter |
| WBOXNTCHN48 | CTGACY | 6 | Hormone | MeJA | Nicotiana tabacum (tobacco) | W box identified in the region between -125 and -69 of a tobacco class I basic chitinase gene CHN48 |
| WBOXNTERF3 | TGACY | 5 | Stress | Wound | Nicotiana tabacum (tobacco) | W box found in the promoter region of a transcriptional repressor ERF3 gene in tobacco |
| WINPSTPIIIK | AAGCGTAAGT | 10 | Stress | Wound | Solanum tuberosum (potato) | Binding site of wound-inducible nuclear protein from wounded tomato leaves |
| WRECSAA01 | AAWGTATCSA | 10 | Stress | Wound | Cucumis sativas (cucumber) | Wound-responsive element (WRE) found in the promoter region of cucumber (C.s.) ascorbate oxidase gene, CsAAO1 |
| WRKY71OS | TGAC | 4 | Hormone | MeJA | Oryza sativa (rice); Petroselinum crispum (parsley); | A core of TGAC-containing W-box of, e.g., Amy32b promoter |
| WUSATAg | TTAATGG | 7 | Unclassified | Unclassified | Oryza sativa (rice) | Target sequence of WUS in the intron of AGAMOUS gene in Arabidopsis |
| XYLAT | ACAAAGAA | 8 | Development | Meristem | Arabidopsis thaliana | cis-element identified among the promoters of the core xylem gene set |
| YREGIONNTPRB1B | TGTGACATTGAAATTCTTTGACTTTA | 26 | Hormone | Ethylene | Tobacco (Nicotiana tabacum) | Y region found in tobacco (N.t.) PRB-1b gene promoter |
| ZDNAFORMINGATCAB1 | ATACGTGT | 8 | Light | Light | Arabidopsis thaliana | Z-DNA-forming sequence found in the Arabidopsis (A.t.) chlorophyll a/b binding protein gene (cab1) promoter |
没有匹配的元件